NSCL Bioinformatics Lab

Welcome to Our Bioinformatics Lab!

4mCPred-CNN: Prediction of DNA N4-Methylcytosine in mouse genome using Convolutional Neural Network

Input length is 41bp and should contain only A, C, G, and T. The input format is Fasta like:
>seq
CCAGGCAAGAAGCTACGGAACTGACATTAGTTTAGGGCCTG

You can download the datasets used for this tools from here:

Additional experiment resutls on random negative sequences
Results

[To be added later ...]

Engineering, 567 Baekje-daero, Deokjin-gu, Jeonju-si, Jeollabuk-do, 54896 Republic of Korea